Online Inquiry
ARPC5 Knockout Cell Line
SPL-00475
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | ARPC5 |
| Gene Abbr. | ARPC5 |
| Gene ID | 10092 |
| Full Name | actin related protein 2/3 complex subunit 5 |
| Alias | ARC16, dJ127C7.3, p16-Arc |
| Species | Human |
| Genomic Locus | chr1:183633093 |
| Transcript | NM_005717 |
| WT Expression Level | 100.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p16 subunit, has yet to be determined. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ARPC5. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACTCTTGGTGTTGATAGGG |
| PCR Primer |
Forward: TCTTCTATGTCAAAGATAGCAAACAGT Reverse: TAACATCCTGGAAACCAACACATTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.