ARPC1B cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ARPC1B cDNA ORF Clone, Human, untagged

ARPC1B cDNA ORF Clone, Human, untagged

SPD-00907

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human actin related protein 2/3 complex, subunit 1B, 41kDa.
Target Information
Species Human
Target Name ARPC1B
Gene Abbr. ARPC1B
Gene ID 10095
Full Name actin related protein 2/3 complex subunit 1B
Alias ARC41, IMD71, PLTEID, p40-ARC, p41-ARC
Product Details
Description Full length Clone DNA of Human actin related protein 2/3 complex, subunit 1B, 41kDa.
NCBI Ref Seq NM_005720.2
RefSeq ORF Size 1119 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.12kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.