ARPC1A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ARPC1A cDNA ORF Clone, Human, untagged

ARPC1A cDNA ORF Clone, Human, untagged

SPD-00867

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human actin related protein 2/3 complex, subunit 1A, 41kDa.
Target Information
Species Human
Target Name ARPC1A
Gene Abbr. ARPC1A
Gene ID 10552
Full Name actin related protein 2/3 complex subunit 1A
Alias Arc40, HEL-68, HEL-S-307, SOP2Hs, SOP2L
Product Details
Description Full length Clone DNA of Human actin related protein 2/3 complex, subunit 1A, 41kDa.
NCBI Ref Seq BC039594
RefSeq ORF Size 1113 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.