Online Inquiry
ARNTL Knockout Cell Line
SPL-00469
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | ARNTL |
| Gene Abbr. | ARNTL |
| Gene ID | 406 |
| Full Name | aryl hydrocarbon receptor nuclear translocator like |
| Alias | BMAL1, BMAL1c, JAP3, MOP3, PASD3 |
| Species | Human |
| Genomic Locus | chr11:13358445 |
| Transcript | NM_001178 |
| WT Expression Level | 8.33 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with CLOCK. This heterodimer binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of ARNTL. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTCAGATTGAAAAGCGGCGT |
| PCR Primer |
Forward: AGTGAGACCATTTTCTTGGAGACTT Reverse: GCAAGGACATAAAGGACAATAGAGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.