Online Inquiry
ARMC5 Knockout Cell Line
SPL-00453
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | ARMC5 |
| Gene Abbr. | ARMC5 |
| Gene ID | 79798 |
| Full Name | armadillo repeat containing 5 |
| Alias | AIMAH2 |
| Species | Human |
| Genomic Locus | chr16:31461960 |
| Transcript | NM_001105247 |
| WT Expression Level | 4.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. The ARM repeat is a tandemly repeated sequence motif with approximately 40 amino acid long. This repeat is implicated in mediating protein-protein interactions. The encoded protein contains seven ARM repeats. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of ARMC5. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AACCGAACGGCCCGTGCCCT |
| PCR Primer |
Forward: GACCATTAGCCTCTTCTGAAAGC Reverse: GACAGACACTCAAGCCTTTCTTCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.