ARMC5 Knockout Cell Line - CD BioSciences

service-banner

ARMC5 Knockout Cell Line

ARMC5 Knockout Cell Line

SPL-00452

Size Price
1 Unit Online Inquiry
Description
16bp deletion
Target Information
Target Name ARMC5
Gene Abbr. ARMC5
Gene ID 79798
Full Name armadillo repeat containing 5
Alias AIMAH2
Species Human
Genomic Locus chr16:31461960
Transcript NM_001105247
WT Expression Level 4.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. The ARM repeat is a tandemly repeated sequence motif with approximately 40 amino acid long. This repeat is implicated in mediating protein-protein interactions. The encoded protein contains seven ARM repeats. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of ARMC5.
Description 16bp deletion
Parental Cell Line C631
Guide RNA Sequence AACCGAACGGCCCGTGCCCT
PCR Primer Forward: GACCATTAGCCTCTTCTGAAAGC
Reverse: GACAGACACTCAAGCCTTTCTTCT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.