Online Inquiry
ARMC10 Knockout Cell Line
SPL-00447
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | ARMC10 |
| Gene Abbr. | ARMC10 |
| Gene ID | 83787 |
| Full Name | armadillo repeat containing 10 |
| Alias | PNAS-112, PNAS112, PSEC0198, SVH |
| Species | Human |
| Genomic Locus | chr7:103083743 |
| Transcript | NM_001161009 |
| WT Expression Level | 37.72 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of ARMC10. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTACCTGCTGGAGTCAACGG |
| PCR Primer |
Forward: AGAGCCTGTTTCAAAAATAACCTCG Reverse: TTACCGCTAGTGTGTAAGAATGGAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.