Online Inquiry
ARID5B Knockout Cell Line
SPL-00414
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 274bp insertion |
| Target Information | |
|---|---|
| Target Name | ARID5B |
| Gene Abbr. | ARID5B |
| Gene ID | 84159 |
| Full Name | AT-rich interaction domain 5B |
| Alias | DESRT, MRF-2, MRF2 |
| Species | Human |
| Genomic Locus | chr10:62050962 |
| Transcript | NM_032199 |
| WT Expression Level | 6.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 274bp insertion in a coding exon of ARID5B. |
| Description | 274bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATTCCAACAACAATTCCGA |
| PCR Primer |
Forward: AGAAACCCATGCAAGTGAAAATGTA Reverse: GAGGTAGGAAGTCTTTCTGTTGACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.