Online Inquiry
ARID1B Knockout Cell Line
SPL-00406
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | ARID1B |
| Gene Abbr. | ARID1B |
| Gene ID | 57492 |
| Full Name | AT-rich interaction domain 1B |
| Alias | 6A3-5, BAF250B, BRIGHT, CSS1, DAN15 |
| Species | Human |
| Genomic Locus | chr6:156829257 |
| Transcript | NM_017519 |
| WT Expression Level | 14.57 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ARID1B. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGACCTCAGTTGTATGGCAT |
| PCR Primer |
Forward: GGATGTTTTGTCAGGTCATTGTTTTTA Reverse: CAGCAAAAGGCAAAGACAAAACTATT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.