ARID1A Knockout Cell Line - CD BioSciences

service-banner

ARID1A Knockout Cell Line

ARID1A Knockout Cell Line

SPL-00401

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name ARID1A
Gene Abbr. ARID1A
Gene ID 8289
Full Name AT-rich interaction domain 1A
Alias B120, BAF250, BAF250a, BM029, C1orf4
Species Human
Genomic Locus chr1:26729696
Transcript NM_006015
WT Expression Level 32.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ARID1A.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TGGGTTAGTCCCGCCATA
PCR Primer Forward: TACTAGGTTGGTCTCATTGCTCTTT
Reverse: GGTCAAGGTAATCACAATCACCATC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.