Online Inquiry
Arhgef7 cDNA ORF Clone, Mouse, N-HA tag
SPD-03795
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse Rho guanine nucleotide exchange factor (GEF7) with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Cool1/βPix |
Gene Abbr. | Arhgef7 |
Gene ID | 54126 |
Full Name | Rho guanine nucleotide exchange factor (GEF7) |
Alias | C, Cool, P, PIX, Pak3bp |
Introduction | Cool/Pix proteins comprise a family of guanine nucleotide exchange factors (GEFs) localized to focal adhesions. The family consists of two isoforms, cool2/αpix and cool1/βPix, the latter having two splice variants that vary in their carboxy termini. Cool1/βPix, like other GEFs, has a DH (Dbl homology) domain, which allows binding of small GTPases and GDP/GTP exchange, and a PH (Pleckstrin homology) domain, which is important in regulating subcellular localization. Cool1/βPix also has an SH3 domain, which binds to the PAK kinase, a downstream effector of cdc42 and Rac. Phosphorylation of cool1/βPix by PAK2 downstream of MAPK signaling alters the localization of a complex containing PAK2 and cool-1/βPix, regulating formation of growth cones in response to growth factors. Growth factor induced activation of Rac1 via cool1/βPix was later shown to occur independently of subcellular localization. Endothelin-1 stimulation of mesangial cells stimulates the protein kinase A (PKA) pathway, resulting in translocation of cool-1/βPix and activation of cdc42. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse Rho guanine nucleotide exchange factor (GEF7) with N terminal HA tag. |
NCBI Ref Seq | NM_017402.4 |
RefSeq ORF Size | 1941 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.