Arhgef7 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Arhgef7 cDNA ORF Clone, Mouse, C-FLAG tag

Arhgef7 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-03787

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Rho guanine nucleotide exchange factor (GEF7) with C terminal Flag tag.
Target Information
Species Mouse
Target Name Cool1/βPix
Gene Abbr. Arhgef7
Gene ID 54126
Full Name Rho guanine nucleotide exchange factor (GEF7)
Alias C, Cool, P, PIX, Pak3bp
Introduction Cool/Pix proteins comprise a family of guanine nucleotide exchange factors (GEFs) localized to focal adhesions. The family consists of two isoforms, cool2/αpix and cool1/βPix, the latter having two splice variants that vary in their carboxy termini. Cool1/βPix, like other GEFs, has a DH (Dbl homology) domain, which allows binding of small GTPases and GDP/GTP exchange, and a PH (Pleckstrin homology) domain, which is important in regulating subcellular localization. Cool1/βPix also has an SH3 domain, which binds to the PAK kinase, a downstream effector of cdc42 and Rac. Phosphorylation of cool1/βPix by PAK2 downstream of MAPK signaling alters the localization of a complex containing PAK2 and cool-1/βPix, regulating formation of growth cones in response to growth factors. Growth factor induced activation of Rac1 via cool1/βPix was later shown to occur independently of subcellular localization. Endothelin-1 stimulation of mesangial cells stimulates the protein kinase A (PKA) pathway, resulting in translocation of cool-1/βPix and activation of cdc42.
Product Details
Description Full length Clone DNA of Mouse Rho guanine nucleotide exchange factor (GEF7) with C terminal Flag tag.
NCBI Ref Seq NM_017402.4
RefSeq ORF Size 1941 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.