Online Inquiry
ARHGEF39 cDNA ORF Clone, Human, untagged
SPD-00827
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Rho guanine nucleotide exchange factor (GEF) 39 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | ARHGEF39 |
| Gene Abbr. | ARHGEF39 |
| Gene ID | 84904 |
| Full Name | Rho guanine nucleotide exchange factor 39 |
| Alias | C9orf100 |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Rho guanine nucleotide exchange factor (GEF) 39 |
| NCBI Ref Seq | NM_032818.2 |
| RefSeq ORF Size | 1008 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.