ARHGEF3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ARHGEF3 cDNA ORF Clone, Human, untagged

ARHGEF3 cDNA ORF Clone, Human, untagged

SPD-00824

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Rho guanine nucleotide exchange factor (GEF) 3.
Target Information
Species Human
Target Name ARHGEF3
Gene Abbr. ARHGEF3
Gene ID 50650
Full Name Rho guanine nucleotide exchange factor 3
Alias GEF3, STA3, XPLN
Product Details
Description Full length Clone DNA of Human Rho guanine nucleotide exchange factor (GEF) 3.
NCBI Ref Seq BC054345
RefSeq ORF Size 1581 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.