ARHGEF1 Knockout Cell Line - CD BioSciences

service-banner

ARHGEF1 Knockout Cell Line

ARHGEF1 Knockout Cell Line

SPL-00370

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name ARHGEF1
Gene Abbr. ARHGEF1
Gene ID 9138
Full Name Rho guanine nucleotide exchange factor 1
Alias GEF1, IMD62, LBCL2, LSC, P115-RHOGEF
Species Human
Genomic Locus chr19:41888221
Transcript NM_004706
WT Expression Level 47.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of ARHGEF1.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence CGATGATGCTGACGGGAACC
PCR Primer Forward: GAATCTGTGAGTAACCACCCTGG
Reverse: GAAAAGGCCAAGAAGACAGCATC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.