Online Inquiry
ARHGEF1 Knockout Cell Line
SPL-00369
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | ARHGEF1 |
| Gene Abbr. | ARHGEF1 |
| Gene ID | 9138 |
| Full Name | Rho guanine nucleotide exchange factor 1 |
| Alias | GEF1, IMD62, LBCL2, LSC, P115-RHOGEF |
| Species | Human |
| Genomic Locus | chr19:41888221 |
| Transcript | NM_004706 |
| WT Expression Level | 47.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of ARHGEF1. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGATGATGCTGACGGGAACC |
| PCR Primer |
Forward: GAATCTGTGAGTAACCACCCTGG Reverse: GAAAAGGCCAAGAAGACAGCATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.