Online Inquiry
ARHGAP32 Knockout Cell Line
SPL-00350
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | ARHGAP32 |
| Gene Abbr. | ARHGAP32 |
| Gene ID | 9743 |
| Full Name | Rho GTPase activating protein 32 |
| Alias | GC-GAP, GRIT, PX-RICS, RICS, p200RhoGAP |
| Species | Human |
| Genomic Locus | chr11:128988071 |
| Transcript | NM_001142685 |
| WT Expression Level | 3.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of ARHGAP32. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAGAGATATGGCATCGTGGA |
| PCR Primer |
Forward: AGGTTATCAAAGTAAGTGAATCTGTTT Reverse: TGTAGTGGATTAATTTTTGCTCCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.