Online Inquiry
ARHGAP31 Knockout Cell Line
SPL-00349
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
8bp deletion |
Target Information | |
---|---|
Target Name | ARHGAP31 |
Gene Abbr. | ARHGAP31 |
Gene ID | 57514 |
Full Name | Rho GTPase activating protein 31 |
Alias | AOS1, CDGAP |
Species | Human |
Genomic Locus | chr3:119365347 |
Transcript | NM_020754 |
WT Expression Level | 6.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of ARHGAP31. |
Description | 8bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TATAGAGACTCACGGCATCG |
PCR Primer |
Forward: AAGGAACATCACCTACCACTTACAA Reverse: TTTTAATACTCTGGACACCGATGGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.