ARHGAP31 Knockout Cell Line - CD BioSciences

service-banner

ARHGAP31 Knockout Cell Line

ARHGAP31 Knockout Cell Line

SPL-00348

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name ARHGAP31
Gene Abbr. ARHGAP31
Gene ID 57514
Full Name Rho GTPase activating protein 31
Alias AOS1, CDGAP
Species Human
Genomic Locus chr3:119365347
Transcript NM_020754
WT Expression Level 6.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ARHGAP31.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TATAGAGACTCACGGCATCG
PCR Primer Forward: AAGGAACATCACCTACCACTTACAA
Reverse: TTTTAATACTCTGGACACCGATGGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.