ARF6 Knockout Cell Line - CD BioSciences

service-banner

ARF6 Knockout Cell Line

ARF6 Knockout Cell Line

SPL-00311

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name Arf6
Gene Abbr. ARF6
Gene ID 382
Full Name ADP ribosylation factor 6
Species Human
Genomic Locus chr14:49894018
Transcript NM_001663
WT Expression Level 26.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the human ARF gene family, which is part of the RAS superfamily. The ARF genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The product of this gene is localized to the plasma membrane, and regulates vesicular trafficking, remodelling of membrane lipids, and signaling pathways that lead to actin remodeling. A pseudogene of this gene is located on chromosome 7. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ARF6.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CCGCATCGATGAGGCTCGCC
PCR Primer Forward: GACACCTGAATGCCCCCG
Reverse: CATCCTAACGCAAAGCCAACAAAAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.