ARF3 Knockout Cell Line - CD BioSciences

service-banner

ARF3 Knockout Cell Line

ARF3 Knockout Cell Line

SPL-00308

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name ARF3
Gene Abbr. ARF3
Gene ID 377
Full Name ADP ribosylation factor 3
Species Human
Genomic Locus chr12:48940025
Transcript NM_001659
WT Expression Level 157.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction ADP-ribosylation factor 3 (ARF3) is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6) and members of each class share a common gene organization. The ARF3 gene contains five exons and four introns. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of ARF3.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence AGGACAAGATTCGACCCCTC
PCR Primer Forward: AATATTTGCTCCCTTTCCTCCCTTT
Reverse: AGCTTTTGTTCCATTGTTGGTGTTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.