Online Inquiry
ARF1 Knockout Cell Line
SPL-00306
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | ARF1 |
| Gene Abbr. | ARF1 |
| Gene ID | 375 |
| Full Name | ADP ribosylation factor 1 |
| Alias | PVNH8 |
| Species | Human |
| Genomic Locus | chr1:228097616 |
| Transcript | NM_001658 |
| WT Expression Level | 286.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | ADP-ribosylation factor 1 (ARF1) is a member of the human ARF gene family. The family members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking as activators of phospholipase D. The gene products, including 6 ARF proteins and 11 ARF-like proteins, constitute a family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2 and ARF3), class II (ARF4 and ARF5) and class III (ARF6), and members of each class share a common gene organization. The ARF1 protein is localized to the Golgi apparatus and has a central role in intra-Golgi transport. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ARF1. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGACAGAGAGCGTGTGAACG |
| PCR Primer |
Forward: CACTACTTCCAGAACACACAAGGTA Reverse: TCCAGTAACCCCTACCACCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.