Online Inquiry
ARAP3 Knockout Cell Line
SPL-00301
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | ARAP3 |
| Gene Abbr. | ARAP3 |
| Gene ID | 64411 |
| Full Name | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 |
| Alias | CENTD3, DRAG1 |
| Species | Human |
| Genomic Locus | chr5:141679990 |
| Transcript | NM_022481 |
| WT Expression Level | 2.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. An alternatively spliced transcript has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Sep 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of ARAP3. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACTTCGGCCTGGACTCAAG |
| PCR Primer |
Forward: CCTGAAGGGAAAGGTCTATTGGTTA Reverse: GACCGTGTTTGGTGGACTCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.