Online Inquiry
ARAF Knockout Cell Line
SPL-00296
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | A-Raf |
| Gene Abbr. | ARAF |
| Gene ID | 369 |
| Full Name | A-Raf proto-oncogene, serine/threonine kinase |
| Alias | A-RAF, ARAF1, PKS2, RAFA1 |
| Species | Human |
| Genomic Locus | chrX:47563042 |
| Transcript | NM_001654 |
| WT Expression Level | 47.44 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ARAF. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCGTGCGTTGCTTGTTGGGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.