Araf cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Araf cDNA ORF Clone, Mouse, C-HA tag

Araf cDNA ORF Clone, Mouse, C-HA tag

SPD-00795

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse v-raf murine sarcoma 3611 viral oncogene homolog with C terminal HA tag.
Target Information
Species Mouse
Target Name A-Raf
Gene Abbr. Araf
Gene ID 11836
Full Name Araf proto-oncogene, serine/threonine kinase
Alias 1200013E08Rik, A-, A-Raf, AW495444, Ar
Introduction A-Raf, B-Raf, and c-Raf (Raf-1) are the main effectors recruited by GTP-bound Ras to activate the MEK-MAP kinase pathway. Activation of c-Raf is the best understood and involves phosphorylation at multiple activating sites including Ser338, Tyr341, Thr491, Ser494, Ser497, and Ser499. p21-activated protein kinase (PAK) has been shown to phosphorylate c-Raf at Ser338, and the Src family phosphorylates Tyr341 to induce c-Raf activity. Ser338 of c-Raf corresponds to similar sites in A-Raf (Ser299) and B-Raf (Ser445), although this site is constitutively phosphorylated in B-Raf. Inhibitory 14-3-3 binding sites on c-Raf (Ser259 and Ser621) can be phosphorylated by Akt and AMPK, respectively. While A-Raf, B-Raf, and c-Raf are similar in sequence and function, differential regulation has been observed. Of particular interest, B-Raf contains three consensus Akt phosphorylation sites (Ser364, Ser428, and Thr439) and lacks a site equivalent to Tyr341 of c-Raf. Research studies have shown that the B-Raf mutation V600E results in elevated kinase activity and is commonly found in malignant melanoma. Six residues of c-Raf (Ser29, Ser43, Ser289, Ser296, Ser301, and Ser642) become hyperphosphorylated in a manner consistent with c-Raf inactivation. The hyperphosphorylation of these six sites is dependent on downstream MEK signaling and renders c-Raf unresponsive to subsequent activation events.
Product Details
Description Full length Clone DNA of Mouse v-raf murine sarcoma 3611 viral oncogene homolog with C terminal HA tag.
NCBI Ref Seq NM_001159645.1
RefSeq ORF Size 561 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.