Online Inquiry
AR Knockout Cell Line
SPL-00287
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | Androgen Receptor |
| Gene Abbr. | AR |
| Gene ID | 367 |
| Full Name | androgen receptor |
| Alias | AIS, AR8, DHTR, HUMARA, HYSP1 |
| Species | Human |
| Genomic Locus | chrX:67643350 |
| Transcript | NM_000044 |
| WT Expression Level | 12.69 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of AR. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACTATGGAGCTCTCACATG |
| PCR Primer |
Forward: CACCCTACAACCATCATCTTTAGGA Reverse: AAAGGTTAGTGTCTCTCTCTGGAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.