Online Inquiry
AR cDNA ORF Clone, Human, N-FLAG tag
SPD-00704
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human androgen receptor with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Androgen Receptor |
Gene Abbr. | AR |
Gene ID | 367 |
Full Name | androgen receptor |
Alias | AIS, AR8, DHTR, HUMARA, HYSP1 |
Introduction | The androgen receptor (AR) is an approx. 110 kDa androgen-dependent transcription factor that is a member of the steroid/nuclear receptor gene superfamily. The AR signaling pathway plays a key role in development and function of male reproductive organs, including the prostate and epididymis. AR also plays a role in nonreproductive organs, such as muscle, hair follicles, and brain. Abnormalities in the AR signaling pathway have been linked to a number of diseases, including prostate cancer, Kennedy's disease and male infertility. The PI3K/Akt signaling pathway plays an important role in regulating AR activity through phosphorylation of AR at Ser213/210 and Ser791/790. Growth factors or cytokines may induce phosphorylation of AR through the PI3K/Akt pathway. IGF-1 activates the phosphatidylinositol 3-kinase(PI3K)/AKT pathway in LNCap at high passage number and increases phosphorylation of of AR at Ser213/210 (see western blot) and Ser791/790 (Lin et al. 2003). The western blot results also show that inhibition of the PI3K/Akt pathway by LY294002 prior to incubation with IGF-1 suppressed AR phosphorylation at Ser213/210. Activation of the PI3K/AKt pathway is thought to have a survival role in prostate cancer by protecting cells from apoptosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human androgen receptor with N terminal Flag tag. |
NCBI Ref Seq | NM_001011645.1 |
RefSeq ORF Size | 1167 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.21kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.