Online Inquiry
APOE Knockout Cell Line
SPL-00279
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | APOE |
| Gene Abbr. | APOE |
| Gene ID | 348 |
| Full Name | apolipoprotein E |
| Alias | AD2, APO-E, ApoE4, LDLCQ5, LPG |
| Species | Human |
| Genomic Locus | chr19:44907865 |
| Transcript | NM_000041 |
| WT Expression Level | 8.08 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. [provided by RefSeq, Jun 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of APOE. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTTTTGGGATTACCTGCGC |
| PCR Primer |
Forward: CCTTGAACTTGTTCCACACAGGATG Reverse: AAACCTGGACCTGGGGAGGTAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.