Online Inquiry
APOBEC3C Knockout Cell Line
SPL-00274
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | APOBEC3C |
| Gene Abbr. | APOBEC3C |
| Gene ID | 27350 |
| Full Name | apolipoprotein B mRNA editing enzyme catalytic subunit 3C |
| Alias | A3C, APOBEC1L, ARDC2, ARDC4, ARP5 |
| Species | Human |
| Genomic Locus | chr22:39015693 |
| Transcript | NM_014508 |
| WT Expression Level | 4.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of APOBEC3C. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCGGCGCTTTATACCTTCCA |
| PCR Primer |
Forward: GTCTCTGCATTGGGGTTTCTCTCTT Reverse: GCACATCACTTATTGTTGCGTTTTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.