APH1A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

APH1A cDNA ORF Clone, Human, untagged

APH1A cDNA ORF Clone, Human, untagged

SPD-00751

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human APH1A gamma secretase subunit.
Target Information
Species Human
Target Name APH1A
Gene Abbr. APH1A
Gene ID 51107
Full Name aph-1 homolog A, gamma-secretase subunit
Alias 6530402N02Rik, APH-1, APH-1A, CGI-78
Product Details
Description Full length Clone DNA of Human APH1A gamma secretase subunit.
RefSeq ORF Size 795 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.