Online Inquiry
ANGPTL4 Knockout Cell Line
SPL-00248
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 40bp insertion |
| Target Information | |
|---|---|
| Target Name | ANGPTL4 |
| Gene Abbr. | ANGPTL4 |
| Gene ID | 51129 |
| Full Name | angiopoietin like 4 |
| Alias | ARP4, FIAF, HARP, HFARP, NL2 |
| Species | Human |
| Genomic Locus | chr19:8366040 |
| Transcript | NM_001039667 |
| WT Expression Level | 0.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 40bp insertion in a coding exon of ANGPTL4. |
| Description | 40bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTTGCAGATGCTGAATTCGC |
| PCR Primer |
Forward: ATGGAGATTTGGAAGGATGGATGAG Reverse: CTCATGGTCTAGGTGCTTGTGGTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.