Anapc2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Anapc2 cDNA ORF Clone, Mouse, untagged

Anapc2 cDNA ORF Clone, Mouse, untagged

SPD-00729

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse anaphase promoting complex subunit 2.
Target Information
Species Mouse
Target Name APC2/ANAPC2
Gene Abbr. Anapc2
Gene ID 99152
Full Name anaphase promoting complex subunit 2
Alias 9230107K09Rik, AL024279, AP, Apc2, Emi
Product Details
Description Full length Clone DNA of Mouse anaphase promoting complex subunit 2.
NCBI Ref Seq NM_175300.4
RefSeq ORF Size 2514 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.