ANAPC16 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ANAPC16 cDNA ORF Clone, Human, untagged

ANAPC16 cDNA ORF Clone, Human, untagged

SPD-00689

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human anaphase promoting complex subunit 16
Target Information
Species Human
Target Name ANAPC16/APC16
Gene Abbr. ANAPC16
Gene ID 119504
Full Name anaphase promoting complex subunit 16
Alias APC16, C10orf104, CENP-27, MSAG, bA570G20.3
Product Details
Description Full length Clone DNA of Human anaphase promoting complex subunit 16
NCBI Ref Seq NM_001242546.1
RefSeq ORF Size 333 bp
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.