Anapc15 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Anapc15 cDNA ORF Clone, Mouse, untagged

Anapc15 cDNA ORF Clone, Mouse, untagged

SPD-00668

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse anaphase prompoting complex C subunit 15.
Target Information
Species Mouse
Target Name ANAPC15/APC15
Gene Abbr. Anapc15
Gene ID 75430
Full Name anaphase promoting complex C subunit 15
Alias 3200002M19Rik, 6330414C15Rik, APC15
Product Details
Description Full length Clone DNA of Mouse anaphase prompoting complex C subunit 15.
NCBI Ref Seq NM_027532.3
RefSeq ORF Size 399 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.