ANAPC15 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ANAPC15 cDNA ORF Clone, Human, untagged

ANAPC15 cDNA ORF Clone, Human, untagged

SPD-00678

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human anaphase promoting complex subunit 15.
Target Information
Species Human
Target Name ANAPC15/APC15
Gene Abbr. ANAPC15
Gene ID 25906
Full Name anaphase promoting complex subunit 15
Alias APC15, C11orf51, HSPC020
Product Details
Description Full length Clone DNA of Human anaphase promoting complex subunit 15.
NCBI Ref Seq BC005156
RefSeq ORF Size 366 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.