ANAPC11 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ANAPC11 cDNA ORF Clone, Human, untagged

ANAPC11 cDNA ORF Clone, Human, untagged

SPD-00628

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human anaphase promoting complex subunit 11
Target Information
Species Human
Target Name ANAPC11
Gene Abbr. ANAPC11
Gene ID 51529
Full Name anaphase promoting complex subunit 11
Alias APC11, Apc11p, HSPC214
Product Details
Description Full length Clone DNA of Human anaphase promoting complex subunit 11
NCBI Ref Seq NM_001002248.2
RefSeq ORF Size 255 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.26kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.