ANAPC10 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ANAPC10 cDNA ORF Clone, Human, untagged

ANAPC10 cDNA ORF Clone, Human, untagged

SPD-00648

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human anaphase promoting complex subunit 10.
Target Information
Species Human
Target Name ANAPC13/APC13
Gene Abbr. ANAPC10
Gene ID 10393
Full Name anaphase promoting complex subunit 10
Alias APC10, DOC1
Product Details
Description Full length Clone DNA of Human anaphase promoting complex subunit 10.
NCBI Ref Seq BC005217
RefSeq ORF Size 558 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.