Online Inquiry
ALPL Knockout Cell Line
SPL-00240
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | ALPL |
| Gene Abbr. | ALPL |
| Gene ID | 249 |
| Full Name | alkaline phosphatase, biomineralization associated |
| Alias | AP-TNAP, APTNAP, HOPS, TNALP, TNAP |
| Species | Human |
| Genomic Locus | chr1:21564068 |
| Transcript | NM_000478 |
| WT Expression Level | 17.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the alkaline phosphatase family of proteins. There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the tissue non-specific form is located on chromosome 1. The product of this gene is a membrane bound glycosylated enzyme that is not expressed in any particular tissue and is, therefore, referred to as the tissue-nonspecific form of the enzyme. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This enzyme may play a role in bone mineralization. Mutations in this gene have been linked to hypophosphatasia, a disorder that is characterized by hypercalcemia and skeletal defects. [provided by RefSeq, Oct 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of ALPL. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGTGGCATGGTTCACTCTCG |
| PCR Primer |
Forward: AATCCTCAGAACTGAAGCGGG Reverse: CTCACGTCAATGTCCCTGATGTTAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.