AKTIP cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

AKTIP cDNA ORF Clone, Human, untagged

AKTIP cDNA ORF Clone, Human, untagged

SPD-05821

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human AKT interacting protein.
Target Information
Species Human
Target Name FTS
Gene Abbr. AKTIP
Gene ID 64400
Full Name AKT interacting protein
Alias FT1, FTS
Introduction AKTIP is the component of the FTS/Hook/FHIP complex (FHF complex). The FHF complex may function to promote vesicle trafficking and/or fusion via the homotypic vesicular protein sorting complex (the HOPS complex). AKTIP regulates apoptosis by enhancing phosphorylation and activation of AKT1. AKTIP increases release of TNFSF6 via the AKT1/GSK3B/NFATC1 signaling cascade.The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein.
Product Details
Description Full length Clone DNA of Human AKT interacting protein.
NCBI Ref Seq BC001134
RefSeq ORF Size 879 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.