Online Inquiry
AKTIP cDNA ORF Clone, Human, N-FLAG tag
SPD-05817
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human AKT interacting protein with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | FTS |
Gene Abbr. | AKTIP |
Gene ID | 64400 |
Full Name | AKT interacting protein |
Alias | FT1, FTS |
Introduction | AKTIP is the component of the FTS/Hook/FHIP complex (FHF complex). The FHF complex may function to promote vesicle trafficking and/or fusion via the homotypic vesicular protein sorting complex (the HOPS complex). AKTIP regulates apoptosis by enhancing phosphorylation and activation of AKT1. AKTIP increases release of TNFSF6 via the AKT1/GSK3B/NFATC1 signaling cascade.The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human AKT interacting protein with N terminal Flag tag. |
NCBI Ref Seq | BC001134 |
RefSeq ORF Size | 879 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.