Online Inquiry
AKT3 Knockout Cell Line
SPL-00199
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 100bp insertion |
| Target Information | |
|---|---|
| Target Name | Akt |
| Gene Abbr. | AKT3 |
| Gene ID | 10000 |
| Full Name | AKT serine/threonine kinase 3 |
| Alias | MPPH, MPPH2, PKB-GAMMA, PKBG, PRKBG |
| Species | Human |
| Genomic Locus | chr1:243695617 |
| Transcript | NM_001206729 |
| WT Expression Level | 26.64 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 100bp insertion in a coding exon of AKT3. |
| Description | 100bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TAAGGTAAATCCACATCTTG |
| PCR Primer |
Forward: AACCCAAACTTTTTCACAGGTTTCT Reverse: GGCCAAGATACTTCCTTTTGAAGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.