Akt1s1 cDNA ORF Clone, Rat, N-Myc tag - CD BioSciences

service-banner

Akt1s1 cDNA ORF Clone, Rat, N-Myc tag

Akt1s1 cDNA ORF Clone, Rat, N-Myc tag

SPD-00493

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat AKT1 substrate 1 (proline-rich) with N terminal Myc tag.
Target Information
Species Rat
Target Name AKT1S1
Gene Abbr. Akt1s1
Gene ID 292887
Full Name AKT1 substrate 1
Alias PRAS40
Introduction Many growth factors and hormones induce the phosphoinositide 3-kinase signaling pathway, which results in the activation of downstream effector proteins such as the serine/threonine kinase Akt. One known Akt substrate is a 40 kDa, proline-rich protein (PRAS40) that binds to 14-3-3 proteins. PRAS40 also binds mTOR to transduce Akt signals to the mTOR complex. Inhibition of mTOR signaling stimulates PRAS40 binding to mTOR, which in turn inhibits mTOR activity. PRAS40 interacts with raptor in mTOR complex 1 (mTORC1) in insulin-deprived cells and inhibits the activation of the mTORC1 pathway mediated by the cell cycle protein Rheb. Phosphorylation of PRAS40 by Akt at Thr246 relieves PRAS40 inhibition of mTORC1. mTORC1 in turn phosphorylates PRAS40 at Ser183.
Product Details
Description Full length Clone DNA of Rat AKT1 substrate 1 (proline-rich) with N terminal Myc tag.
NCBI Ref Seq NM_001106259.3
RefSeq ORF Size 774 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.