Online Inquiry
Akt1s1 cDNA ORF Clone, Rat, C-His tag
SPD-00487
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat AKT1 substrate 1 (proline-rich) with C terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | AKT1S1 |
Gene Abbr. | Akt1s1 |
Gene ID | 292887 |
Full Name | AKT1 substrate 1 |
Alias | PRAS40 |
Introduction | Many growth factors and hormones induce the phosphoinositide 3-kinase signaling pathway, which results in the activation of downstream effector proteins such as the serine/threonine kinase Akt. One known Akt substrate is a 40 kDa, proline-rich protein (PRAS40) that binds to 14-3-3 proteins. PRAS40 also binds mTOR to transduce Akt signals to the mTOR complex. Inhibition of mTOR signaling stimulates PRAS40 binding to mTOR, which in turn inhibits mTOR activity. PRAS40 interacts with raptor in mTOR complex 1 (mTORC1) in insulin-deprived cells and inhibits the activation of the mTORC1 pathway mediated by the cell cycle protein Rheb. Phosphorylation of PRAS40 by Akt at Thr246 relieves PRAS40 inhibition of mTORC1. mTORC1 in turn phosphorylates PRAS40 at Ser183. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat AKT1 substrate 1 (proline-rich) with C terminal His tag. |
NCBI Ref Seq | NM_001106259.3 |
RefSeq ORF Size | 774 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.