Online Inquiry
AKAP9 Knockout Cell Line
SPL-00176
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | AKAP9 |
| Gene Abbr. | AKAP9 |
| Gene ID | 10142 |
| Full Name | A-kinase anchoring protein 9 |
| Alias | AKAP-9, AKAP350, AKAP450, CG-NAP, HYPERION |
| Species | Human |
| Genomic Locus | chr7:92001156 |
| Transcript | NM_005751 |
| WT Expression Level | 9.27 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternate splicing of this gene results in at least two isoforms that localize to the centrosome and the Golgi apparatus, and interact with numerous signaling proteins from multiple signal transduction pathways. These signaling proteins include type II protein kinase A, serine/threonine kinase protein kinase N, protein phosphatase 1, protein phosphatase 2a, protein kinase C-epsilon and phosphodiesterase 4D3. [provided by RefSeq, Aug 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of AKAP9. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTACTATATCAGTTTCGAAC |
| PCR Primer |
Forward: TGAAGCAGTATAATTTGCCAGAAGC Reverse: CCTTAAAGCATTCTCCATTTCTCCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.