AHR Knockout Cell Line - CD BioSciences

service-banner

AHR Knockout Cell Line

AHR Knockout Cell Line

SPL-00154

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name AHR
Gene Abbr. AHR
Gene ID 196
Full Name aryl hydrocarbon receptor
Alias RP85, bHLHe76
Species Human
Genomic Locus chr7:17309996
Transcript NM_001621
WT Expression Level 1.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. [provided by RefSeq, Sep 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of AHR.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence GGTCCAACTCTGTATTAAGT
PCR Primer Forward: ATTCGGAAGAATTTAACCCATTCCC
Reverse: ACCCTTCTGTCTTACCATCAAAGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.