Online Inquiry
AGO1 Knockout Cell Line
SPL-00142
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | AGO1 |
| Gene Abbr. | AGO1 |
| Gene ID | 26523 |
| Full Name | argonaute RISC component 1 |
| Alias | EIF2C, EIF2C1, GERP95, Q99, hAgo1 |
| Species | Human |
| Genomic Locus | chr1:35892594 |
| Transcript | NM_012199 |
| WT Expression Level | 10.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of AGO1. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTGCGATCACCAAAGATCTG |
| PCR Primer |
Forward: ATAATAGATGGGACATTGCCTGGAC Reverse: CCCCTCACCCTAAAACATACTTTCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.