Online Inquiry
ADIPOR2 Knockout Cell Line
SPL-00109
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | ADIPOR |
| Gene Abbr. | ADIPOR2 |
| Gene ID | 79602 |
| Full Name | adiponectin receptor 2 |
| Alias | ACDCR2, PAQR2 |
| Species | Human |
| Genomic Locus | chr12:1772859 |
| Transcript | NM_024551 |
| WT Expression Level | 39.61 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The adiponectin receptors, ADIPOR1 (MIM 607945) and ADIPOR2, serve as receptors for globular and full-length adiponectin (MIM 605441) and mediate increased AMPK (see MIM 602739) and PPAR-alpha (PPARA; MIM 170998) ligand activities, as well as fatty acid oxidation and glucose uptake by adiponectin (Yamauchi et al., 2003 [PubMed 12802337]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of ADIPOR2. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATACAGTGATGAAGCTCCTC |
| PCR Primer |
Forward: TTCTTGTCTAAGGCCTTGTTTTGAC Reverse: GGTTTCTGTTTTGGAAGGGCTAAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.