Online Inquiry
ADIPOR1 Knockout Cell Line
SPL-00107
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | ADIPOR |
| Gene Abbr. | ADIPOR1 |
| Gene ID | 51094 |
| Full Name | adiponectin receptor 1 |
| Alias | ACDCR1, CGI-45, CGI45, PAQR1, TESBP1A |
| Species | Human |
| Genomic Locus | chr1:202946534 |
| Transcript | NM_015999 |
| WT Expression Level | 176.84 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. A pseudogene of this gene is located on chromosome 14. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of ADIPOR1. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACAACGACTATCTGCTACA |
| PCR Primer |
Forward: ACTTTGTTGGGCTCTATAATCCCTT Reverse: CTATTACCTAGGACCATTCAGAGCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.