Adipoq cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Adipoq cDNA ORF Clone, Mouse, untagged

Adipoq cDNA ORF Clone, Mouse, untagged

SPD-00405

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse adiponectin, C1Q and collagen domain containing.
Target Information
Species Mouse
Target Name Adiponectin
Gene Abbr. Adipoq
Gene ID 11450
Full Name adiponectin, C1Q and collagen domain containing
Alias 30kDa, APN, Acd, Acdc, Acr
Product Details
Description Full length Clone DNA of Mouse adiponectin, C1Q and collagen domain containing.
NCBI Ref Seq NM_009605.4
RefSeq ORF Size 744 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.74kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.