ADAP2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ADAP2 cDNA ORF Clone, Human, untagged

ADAP2 cDNA ORF Clone, Human, untagged

SPD-00385

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ArfGAP with dual PH domains 2.
Target Information
Species Human
Target Name ADAP2
Gene Abbr. ADAP2
Gene ID 55803
Full Name ArfGAP with dual PH domains 2
Alias CENTA2, HSA272195, cent-b
Product Details
Description Full length Clone DNA of Human ArfGAP with dual PH domains 2.
NCBI Ref Seq BC033758
RefSeq ORF Size 1143 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.